{ lib, stdenv, fetchFromGitHub, cmake, perl, python3, onetbb, zlib, runCommand, bowtie2, }: stdenv.mkDerivation (finalAttrs: { pname = "bowtie2"; version = "2.5.4"; src = fetchFromGitHub { owner = "BenLangmead"; repo = "bowtie2"; tag = "v${finalAttrs.version}"; fetchSubmodules = true; hash = "sha256-ZbmVOItfAgKdsMrvQIXgKiPtoQJZYfGblCGDoNPjvTU="; }; # because of this flag, gcc on aarch64 cannot find the Threads # Could NOT find Threads (missing: Threads_FOUND) # TODO: check with other distros and report upstream postPatch = '' substituteInPlace CMakeLists.txt \ --replace "-m64" "" ''; nativeBuildInputs = [ cmake ]; buildInputs = [ onetbb zlib python3 perl ]; cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) [ "-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party" ]; # ctest fails because of missing dependencies between tests doCheck = false; passthru.tests = { ctest = runCommand "${finalAttrs.pname}-test" { } '' mkdir $out ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10 ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small ${bowtie2}/bin/bowtie2-inspect-s $out/small ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large ${bowtie2}/bin/bowtie2-inspect-l $out/large ''; }; meta = with lib; { description = "Ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences"; license = licenses.gpl3Plus; homepage = "http://bowtie-bio.sf.net/bowtie2"; changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/v${finalAttrs.version}"; maintainers = with maintainers; [ rybern ]; platforms = platforms.all; mainProgram = "bowtie2"; }; })